Combine multiple FASTA sequence records into a single sequence
Enter multiple FASTA sequences to combine into a single sequence. Non-letter characters will be removed.
Paste multiple FASTA format sequences in the input field. Each sequence should start with a header line beginning with '>'
Select between FASTA format (includes header) or raw sequence only
Optionally format the output with line breaks (60 characters per line) for better readability
Click the "Execute Tool" button to combine your sequences. Download or copy the result when ready
>sequence_1 ACCGACTRM >sequence_2 GGGGGAAAAATTTTTCCCCC >sequence_3 ATGCGTACGTACG
Combine multiple sequences to determine the overall codon usage for a collection of genes.
Join multiple sequence fragments or exons into a single continuous sequence.
Prepare sequences for tools that accept single sequence input but you need to analyze multiple records.
Merge contigs or scaffolds into longer genomic sequences for further analysis.